V 3 R/V 7 Index

2 ‐ SIM 3 : Fw : 5 ’ ‐ GCCTGCAGCTGAGATGCGGCAGAAGCCGGGGACAGTGATGATGAGG ‐ 3 ’ Rv : 5 ’ ‐ CCTCATCATCACTGTCCCCGGCTTCTGCCGCATCTCAGCTGCAGGC

U2OS and U2OS‐HIS‐SUMO2 cell lines [1] were grown in DMEM supplemented with 10% FCS and penicillin/streptomycin (Life Technologies). SLX4+/+ MEFs and SLX4‐/‐ MEFs [2] were also supplemented with non‐essential AAs. Every cell line was checked for mycoplasma contamination regularly. The result was always negative. mSLX4 was amplified by PCR from pBABE‐mSLX4 [2] and cloned into pDONR207 using a BP...

Subject Index Volume 7

25-hydroxyvitamin D3 Effect of serum 25-hydroxyvitamin D3 on insulin resistance and b-cell function in newly diagnosed type 2 diabetes patients, Yang 226–232 5-hydroxytryptamine 2 receptor antagonist Effective treatment with combination of peripheral 5hydroxytryptamine synthetic inhibitor and 5-hydroxytryptamine 2 receptor antagonist on glucocorticoid-induced wholebody insulin resistance with h...

Cover vol.7, no.3

/ 97 06 23 7 v 1 3 J un 1 99 7 Model Building

In this talk I begin with some general discussion of model building in particle theory, emphasizing the need for motivation and testability. Three illustrative examples are then described. The first is the Left-Right model which provides an explanation for the chirality of quarks and leptons. The second is the 331-model which offers a first step to understanding the three generations of quarks ...

2 v 3 1 7 D ec 1 99 7 Chiral anomaly and η − η ′ mixing ∗

We determine the η−η mixing angle via a procedure relatively independent of theoretical assumptions by simultaneously fitting η, η reactions involving the anomaly— η, η → γγ, π+π−γ. We extract reasonably precise renormalized values of the octet and singlet pseudoscalar decay constants F8, F0, as well as the mixing angle θ. * Research supported in part by the National Science Foundation